View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_73 (Length: 259)
Name: NF0688_low_73
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_73 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 30 - 246
Target Start/End: Original strand, 23697409 - 23697625
Alignment:
| Q |
30 |
gttggtgtgtgtaccttagattaatagcattggtctcatgtttttggtcacacaacagtggtaaagtatcaccctttgcagccctgttgcatttggtcaa |
129 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23697409 |
gttggtgtatgtaccttagattaatagcattggtctcatgtttttggtcacgcaacagtggtaaagtatcaccctttgcagccctgttgcatttggtgca |
23697508 |
T |
 |
| Q |
130 |
tgctttgtagtacctctcattcttggatggcttgacttgattgattttaagaacagtcacacacacagttgtctatggaaaatatataaaagcaaaacca |
229 |
Q |
| |
|
|||||||||||||| | ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23697509 |
tgctttgtagtaccacccattcttggatggtttgacttgattgattttaagaacaatcacacacacagttgtctatggaagatatataaaagcaaaacca |
23697608 |
T |
 |
| Q |
230 |
tgtcaacttcatctcac |
246 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
23697609 |
tgtcaacttcatatcac |
23697625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 42 - 214
Target Start/End: Original strand, 22078417 - 22078589
Alignment:
| Q |
42 |
accttagattaatagcattggtctcatgtttttggtcacacaacagtggtaaagtatcaccctttgcagccctgttgcatttggtcaatgctttgtagta |
141 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||| ||||||||||||| |
|
|
| T |
22078417 |
accttagattgatagcattggtctcgtgtttttggtcacacaacagtggtaaagtatcaccctttgcaactctgttgcacttggtgcatgctttgtagta |
22078516 |
T |
 |
| Q |
142 |
cctctcattcttggatggcttgacttgattgattttaagaacagtcacacacacagttgtctatggaaaatat |
214 |
Q |
| |
|
|| | ||||||||||||| || ||||||||||| || | ||||||||||||||||||||||||||||| |||| |
|
|
| T |
22078517 |
ccacccattcttggatggtttcacttgattgatcttcacaacagtcacacacacagttgtctatggaatatat |
22078589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 47 - 171
Target Start/End: Original strand, 123620 - 123745
Alignment:
| Q |
47 |
agattaatagcattggtctcatgtttttggtcacacaacagtggtaaagtatcaccctttgcagccc-tgttgcatttggtcaatgctttgtagtacctc |
145 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||| || || ||||| ||||||||||||||||||| ||||||| || || | ||||||||||||| | |
|
|
| T |
123620 |
agattgatagcattggtctcatggttttcagaacagaatagcggtaaggtatcaccctttgcagcccctgttgcacttagtgcacgctttgtagtaccac |
123719 |
T |
 |
| Q |
146 |
tcattcttggatggcttgacttgatt |
171 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
123720 |
ccattcttggatggtttgacttgatt |
123745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University