View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_78 (Length: 252)

Name: NF0688_low_78
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_78
NF0688_low_78
[»] chr3 (1 HSPs)
chr3 (29-240)||(34567489-34567700)


Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 29 - 240
Target Start/End: Original strand, 34567489 - 34567700
Alignment:
29 acctcgatctccgccggcctcgataacagaacaattccttccagttgtcgcgaaagttcggcttctatatcagttagtttagttttggcgtggtccactt 128  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||    
34567489 acctcgatctccgtcggcctcgataacagaacaattccttccagttgtcgcgaaagttcggcttctatatcagttagtttggttttggcgtggtcgactt 34567588  T
129 cttcatgagtgggccgttcgccgataagtttgagaatggccctggcctgttgaacgtcgtcgatggccccggccatggcggcgattaattcgggatctgc 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
34567589 cttcatgagtgggccgttcgccgataagtttgagaatggccctggcctgttgaacgtcgtcgatggcaccggccatggcggcgattaattcgggatctgc 34567688  T
229 taggtttggcat 240  Q
    ||||||||||||    
34567689 taggtttggcat 34567700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University