View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_82 (Length: 251)

Name: NF0688_low_82
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_82
NF0688_low_82
[»] chr7 (2 HSPs)
chr7 (8-238)||(32059253-32059484)
chr7 (218-251)||(32059188-32059221)
[»] chr3 (1 HSPs)
chr3 (175-207)||(3300423-3300455)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 32059484 - 32059253
Alignment:
8 cgaacaatatccattcttt-catgattccagtacaccaatctatcctcattcacttgcgggtacagcggtatatctaaaattctttgcgctgttccttct 106  Q
    |||| |||||||||||||| || ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
32059484 cgaataatatccattcttttcaggattccagtacaccaatttatcctcattcacttgtgggtacagcggtatatctaaaattctttgcgctgttccttct 32059385  T
107 acaaaaatatgccacacaagctatttgttccatgtttttgtgtcttagtgaatcaagtgacccacaaaatatctttgtaaagccaaagctgccggactca 206  Q
    ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32059384 acaaaaatatgccgcacaagctctttgttccatgtttttgtgtcttagtgaatcaagtgacccacaaaatatctttgtaaagccaaagctgccggactca 32059285  T
207 cgggaggtgtactagagctagcacccaaccaa 238  Q
    ||||||| ||||||||||||||||||||||||    
32059284 cgggaggcgtactagagctagcacccaaccaa 32059253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 32059188 - 32059221
Alignment:
218 ctagagctagcacccaaccaaggctctcctatca 251  Q
    ||||||||||||||||||||||||||||||||||    
32059188 ctagagctagcacccaaccaaggctctcctatca 32059221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 207
Target Start/End: Original strand, 3300423 - 3300455
Alignment:
175 atatctttgtaaagccaaagctgccggactcac 207  Q
    ||||||||||||||| |||||||||||||||||    
3300423 atatctttgtaaagctaaagctgccggactcac 3300455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University