View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_91 (Length: 224)
Name: NF0688_low_91
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0688_low_91 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 18035835 - 18036023
Alignment:
Q |
1 |
aagttttaagagaatttgttttgttaagtagaacatggtttgatttgtattttgttcgtctagtcatcattgcatctaaactatatgatatcttcaataa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
T |
18035835 |
aagttttaagagaatttgttttgttaagtagaacatggtttgatttgtattttgttcgtctagtcatcattacttctaaactatatgatatcttcaataa |
18035934 |
T |
 |
Q |
101 |
ggtcacttcaacatgagagatttcataactctatcttatttctcacccaggaaagttggttttatattttgagaaatgtgtgcattcca |
189 |
Q |
|
|
||||||||||| ||||||||||| ||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18035935 |
ggtcacttcaaaatgagagatttgataactccatcttatttctcacctatgaaagttggttttatattttgagaaatgtgtgcattcca |
18036023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 54
Target Start/End: Original strand, 18029815 - 18029865
Alignment:
Q |
4 |
ttttaagagaatttgttttgttaagtagaacatggtttgatttgtattttg |
54 |
Q |
|
|
|||||||||||||| ||||||||| |||||||||||| |||||||||||| |
|
|
T |
18029815 |
ttttaagagaatttattttgttaaagagaacatggtttaatttgtattttg |
18029865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University