View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_94 (Length: 222)
Name: NF0688_low_94
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_94 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 54910051 - 54909849
Alignment:
| Q |
1 |
atcttttttgaggtttcataatcagtttgtttatggaaatttaccctcaacttcaatagtgcccatgtcacttagtctttagcttcatgggtttttcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54910051 |
atcttttttgaggtttcataatcagtttgtttatggaaatttaccctcaacttcaatagtgcccatgtcacttagtctttagcttcataggtttttcaat |
54909952 |
T |
|
| Q |
101 |
tggcactcagtccaatgagtttattagaattataggatgtctaggacccgacaattttcttttgacagtgtcttttctttttgatcaatttcttgatgat |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909951 |
tggcactcagtacaatgagtttattagaattataggatgtctaggacccgacaattttcttttgacagtgtcttttctttttgatcaatttcttgatgat |
54909852 |
T |
|
| Q |
201 |
gtc |
203 |
Q |
| |
|
||| |
|
|
| T |
54909851 |
gtc |
54909849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University