View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_95 (Length: 222)

Name: NF0688_low_95
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_95
NF0688_low_95
[»] chr4 (1 HSPs)
chr4 (1-193)||(54910027-54910219)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 54910027 - 54910219
Alignment:
1 ctgattatgaaacctcaaaaaagatgaacctatcttttaacaaatcctaagcatttggtatgtctggaatcagtgatactaggactctgagtgagttgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54910027 ctgattatgaaacctcaaaaaagatgaacctatcttttaacaaatcctaagcatttggtatgtctggaatcagtgatactaggactctgagtgagttgtt 54910126  T
101 tgtttgtttgggaagtgatagaaagtttctccattgcgttgataaacttgcgcaaatacttgatgtactcggggaaagtttcaaggttgcaat 193  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54910127 tgtttgtttgggaagtgatagaaagtttatccattgcgttgataaacttgcgcaaatacttgatgtactcggggaaagtttcaaggttgcaat 54910219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University