View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_96 (Length: 221)
Name: NF0688_low_96
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0688_low_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 10202548 - 10202357
Alignment:
Q |
1 |
gtttgataggacatatgccaaaattcaatccacacaaaaacacaatttttaggagagtatggtcnnnnnnnnncctttctaataagagagtatgatcttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
10202548 |
gtttgataggacatatgccaaaattcaatccacacaaaaacacaatttttaggagagtatggtctttttttt-cctttctaataagagagtatgatcttt |
10202450 |
T |
 |
Q |
101 |
aaatttaactgagctccattgtaagaattaactctgtagccaactccaaagatagaaagttgtggggatacttgaagatcccatactgtaatt |
193 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10202449 |
aaatttaactgagctccattgtaagaattaactctgtagccaactccaaagatagaaagttgtggggatacttgaagatcccatactgtaatt |
10202357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University