View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_98 (Length: 213)
Name: NF0688_low_98
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0688_low_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 52831977 - 52831852
Alignment:
Q |
1 |
agagaaagttaaagatgccatgcttcatgcatggacatcttatgaaaaatatgcctggggcaaggatgaacttaaggtgcttttccatttgttttgtatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52831977 |
agagaaagttaaagatgccatgcttcatgcatggacatcttatgaaaaatatgcctggggcaaggatgaacttaaggtgcttttccatttgttttgtatt |
52831878 |
T |
 |
Q |
101 |
ttgtttatctacttcttgatgatgtc |
126 |
Q |
|
|
|||||||||||||||||||| ||||| |
|
|
T |
52831877 |
ttgtttatctacttcttgattatgtc |
52831852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University