View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0689_low_10 (Length: 393)
Name: NF0689_low_10
Description: NF0689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0689_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 1e-69; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 224 - 385
Target Start/End: Original strand, 30389995 - 30390155
Alignment:
Q |
224 |
ttggcagaaggacttggaattgaataataaacaaatatttgagcttgagctgcagtagttgtcctgattaagggtttacttcacttgtgaacttttattc |
323 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
T |
30389995 |
ttggcagaaggacttggaattgaataataaacaaatatttgagcttgagctgcagtagttgtcctgattaagggtctacttcacttgtgaactttacttc |
30390094 |
T |
 |
Q |
324 |
acttttgctggaatgtttaccccacatctcgagatgacctaaatgcaaatacacttcatctc |
385 |
Q |
|
|
|||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30390095 |
acttttgctgaaatg-ttacgccacatctcgagatgacctaaatgcaaatacacttcatctc |
30390155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 30 - 178
Target Start/End: Original strand, 30389831 - 30389983
Alignment:
Q |
30 |
tagcttctatcaaaacaaaacaaaatatgcacacttagatacattgctaaaa----gccttggaacagactttccataccaacatagtgaaagcaaactc |
125 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
30389831 |
tagcttctatcaaaacaaaacaaaatatggacacttagatacattgctaaaattaagccttggcacagactttccataccaacatagtgaaagcaaactt |
30389930 |
T |
 |
Q |
126 |
tggagctaaatatagaaggtagtgagtgtatttgctagcaccatgggaaacac |
178 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
30389931 |
tggagctaaacatagaaggcagtgagtgtatttgctagcaccatgggaaacac |
30389983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 68 - 126
Target Start/End: Original strand, 30380049 - 30380107
Alignment:
Q |
68 |
atacattgctaaaagccttggaacagactttccataccaacatagtgaaagcaaactct |
126 |
Q |
|
|
||||||||||||||||||||| || |||||||||| ||||| |||||||||||||| |
|
|
T |
30380049 |
atacattgctaaaagccttggcccaaactttccatagtgacataatgaaagcaaactct |
30380107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University