View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0689_low_15 (Length: 347)
Name: NF0689_low_15
Description: NF0689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0689_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 10028924 - 10029119
Alignment:
Q |
1 |
ccattttcttaaagcctcttcaactactaacttccctctattagcagcctctactctttccaaagcttcttcaagagccttttt-cttgttttaacttcg |
99 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
10028924 |
ccattttcttaaagcctcttcaactactaatttccctctatttgcagcctctactctttccaaagcttcttcaagagcctgcttgcttgttttaacttca |
10029023 |
T |
 |
Q |
100 |
aatgtagcttcttcaaccctttttaaaacatccattttcgatacatttgcttcgtcaacttgaaacatagcatcatgaactctcttcttagattgt |
195 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10029024 |
aatgtagcttcttcaaccctttttaaaacatccattttcgatacatttgcttcttcaacttgaaacatagcatcatgaactctcttcttagattgt |
10029119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 26987632 - 26987437
Alignment:
Q |
1 |
ccattttcttaaagcctcttcaactactaacttccctctattagcagcctctactctttccaaagcttcttcaagagcctt-tttcttgttttaacttcg |
99 |
Q |
|
|
|||||| |||||||||||||||||| | ||||||||||||| ||||||||||| |||| | |||||||||||| ||||| || | |||| |||||| |
|
|
T |
26987632 |
ccatttccttaaagcctcttcaacttccaacttccctctatctgcagcctctaccctttgtagagcttcttcaagggccttcttgcaagtttgaacttct |
26987533 |
T |
 |
Q |
100 |
aatgtagcttcttcaaccctttttaaaacatccattttcgatacatttgcttcgtcaacttgaaacatagcatcatgaactctcttcttagattgt |
195 |
Q |
|
|
||| ||||| || |||||||| ||||||||||| | ||| ||||||||| ||||||| || ||||||||| ||||||||||| |||||| |
|
|
T |
26987532 |
tctgttgcttcctctacccttttaaaaacatccatctgcgaagaatttgcttcatcaacttcaagcatagcatctgctactctcttctttgattgt |
26987437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University