View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0689_low_21 (Length: 285)
Name: NF0689_low_21
Description: NF0689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0689_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 59 - 239
Target Start/End: Complemental strand, 5893514 - 5893335
Alignment:
Q |
59 |
catcagcatgttcatgagtcaaaataatctgcaactcaaccaaagaactagttttttattctcaaagactgaaaatttctggtcaatccaaatttcaagg |
158 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
5893514 |
catcagcatgttcatgagtcaaaataatctgcaactcaaccaaataactagttttt-attctcaaagactgaaaatttctggtcaattcaaatttcaagg |
5893416 |
T |
 |
Q |
159 |
aacataccgtagacaaaaggaagaaaaactaggctaaaaacaaattgtagtcaatccatgttcttgaatatcatgtttcat |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5893415 |
aacataccgtagacaaaaggaagaaaaactaggctaaaaacaaattgtagtcaatccatgttcttgaatatcatgtttcat |
5893335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1238 times since January 2019
Visitors: 4413