View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0689_low_22 (Length: 280)
Name: NF0689_low_22
Description: NF0689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0689_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 58 - 237
Target Start/End: Complemental strand, 40394289 - 40394110
Alignment:
| Q |
58 |
tcaatgtctcttgagggtgacttaaagacgctgaaaccttctcttatggttgatgcagnnnnnnntgtataccagaatcttattgcagtatccacctcca |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40394289 |
tcaatgtctcttgagggtgacttaaagacgctgaaaccttctcttatggttgatgcagaaaaaaatgtataccagaatcttattgcagtatccacctcca |
40394190 |
T |
|
| Q |
158 |
tttttgagactataatgattagaattgcactcttaagtggaattcattgcactgattttaagtcattccatttgtttcat |
237 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40394189 |
tatttgagactataatgattagaattgcactcttaagtggaattcattgcactgattttaagtcattccatttgtttcat |
40394110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 783 times since January 2019
Visitors: 4393