View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0689_low_25 (Length: 268)

Name: NF0689_low_25
Description: NF0689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0689_low_25
NF0689_low_25
[»] chr1 (1 HSPs)
chr1 (34-229)||(365864-366059)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 34 - 229
Target Start/End: Original strand, 365864 - 366059
Alignment:
34 aagtaatgatttgagaaagtgagagtatggaaaatgtctatgagagctgtttgagatttggcgccattgttgatgagactgtggacatttgaggttatgg 133  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||    
365864 aagtaatgatttgagaaagtgagagtatggaaaatgtctatgagagctgtttgagattcggcgtcattgttgatgagactgtggacatttgaggttatgg 365963  T
134 ttttgaatttgttgacgaaatggaagtcgtcggaagaaattaggaggctaatgagattagggtggttttggaagggacgagtggtggatgatgatg 229  Q
    ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
365964 ttttgaatttgttgacgaaatggaaatcgtcagaagaaattaggaggctaatgagattagggtgtttttggaagggacgagtggtggatgatgatg 366059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 85 times since January 2019
Visitors: 4369