View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0689_low_27 (Length: 264)
Name: NF0689_low_27
Description: NF0689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0689_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 27 - 222
Target Start/End: Complemental strand, 39865470 - 39865275
Alignment:
| Q |
27 |
gaactgatttctgcaattattgtgcagatattcatctaacaatatttgactttgaattagataattcaattgccggttactgatgcagttattgtataga |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39865470 |
gaactgatttctgcaattattgtgcagatattcatctaacagaatttgtctttgaattagataattcaattgccggttactgatgcagttattgtataga |
39865371 |
T |
 |
| Q |
127 |
ttttcagtaagcgatattcgaatttgaattgagaatatctctctgaatcagtgctgactttaatttgtgatcagccaagttattgttgtaacctgt |
222 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39865370 |
ttttcagttagcgatatttgaatttgaattgagaatatctctctgaatcagtgctgactttaatttgcgatcagccaagttattgttgtaacctgt |
39865275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 27 - 222
Target Start/End: Complemental strand, 36342163 - 36341961
Alignment:
| Q |
27 |
gaactgatttctgcaattattgtgcagatattcatctaacaatatttgactttgaattagataattcaattgc----cggtta---ctgatgcagttatt |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| | || | ||||||||||| || |
|
|
| T |
36342163 |
gaactgattgctgcaattattgtgcagatattcatctaacaatatttaactttgaattagagaattcaattgctcatcagtcatcactgatgcagttttt |
36342064 |
T |
 |
| Q |
120 |
gtatagattttcagtaagcgatattcgaatttgaattgagaatatctctctgaatcagtgctgactttaatttgtgatcagccaagttattgttgtaacc |
219 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36342063 |
ctatagattttcagttagcaatatttgaatttgaattgagaatatctctctgaatcagtgctgactttaatttgtgatcagccaagttattgttgtaacc |
36341964 |
T |
 |
| Q |
220 |
tgt |
222 |
Q |
| |
|
||| |
|
|
| T |
36341963 |
tgt |
36341961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University