View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0689_low_32 (Length: 259)
Name: NF0689_low_32
Description: NF0689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0689_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 44968918 - 44969157
Alignment:
| Q |
1 |
tattatatagaagcaaacaacgcgggtttctggaactggacttggttcttggcaaatgggtagaggataatatccataaattggatgaaaatcggattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44968918 |
tattatatagaagcaaacaacgcgggtttctggaactggacttggttcttggcaaatgggtagaggataatatccataaattggatgaaaatcggattaa |
44969017 |
T |
 |
| Q |
101 |
agctctcattcatgtcctcgacttggtaatttacatcttcacattatactcattattatttttattaccctttcactttttctatgtcatttctctgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44969018 |
agctctcattcatgtcctcgacttggtaatttacatcttcacattatactcattattatttttattaccctttcactttttctatgtcatttctctgttt |
44969117 |
T |
 |
| Q |
201 |
gtctatttggatttcattggtaacatgaattgatgatgtc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44969118 |
gtctatttggatttcattggtaacatgaattgatgatgtc |
44969157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 40071309 - 40071384
Alignment:
| Q |
1 |
tattatatagaagcaaacaacgcgggtttctggaactggacttggttcttggcaaatgggtagaggataatatcca |
76 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||| ||||| || |||||||||| ||||||||| || | |||||||| |
|
|
| T |
40071309 |
tattgtatagaagcaagcaacgagggtttctcgaactcgatctggttcttggaaaatgggtacagaacaatatcca |
40071384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University