View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0689_low_35 (Length: 222)
Name: NF0689_low_35
Description: NF0689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0689_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 45597351 - 45597146
Alignment:
| Q |
1 |
ggtggtacgattagaagcttccatctccgcaccacctctcccatgtccttcaatgttgtgtcgagagcttctccttgatttgcattatattctcacgatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45597351 |
ggtggtacgattagaagcttccatctccgcaccacctctcccatgtccttcgatgttgtgtcgagagcttctccttgatttgcattatattctcacgatg |
45597252 |
T |
|
| Q |
101 |
cgaggttcatagcccacgatgcaagttaggcactagctaactctttgatttcttcactccatattccatattttctcaccaaaacgtctttaacaactat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45597251 |
cgaggttcatagcccgcgatgcaagttaggcactagctgcctctttgatttcttcactccatattccatattttctcaccaaaacgtctttaacaactat |
45597152 |
T |
|
| Q |
201 |
gcccta |
206 |
Q |
| |
|
|||||| |
|
|
| T |
45597151 |
gcccta |
45597146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1476 times since January 2019
Visitors: 4416