View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690-Insertion-10 (Length: 69)
Name: NF0690-Insertion-10
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0690-Insertion-10 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 4e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 48013126 - 48013065
Alignment:
Q |
8 |
ttttccttatttgtgttgcgaatcaggtttgtaatgtaccttatcaaatctttttattggag |
69 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48013126 |
ttttccttatttgtgctgcgaatcaggtttgtaatgtaccttatcaaatctttttattggag |
48013065 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University