View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690-Insertion-7 (Length: 217)
Name: NF0690-Insertion-7
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0690-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 217
Target Start/End: Original strand, 52880936 - 52881149
Alignment:
| Q |
7 |
attattcaatgggtatgggaaaattaccaggtgtacaggttactccattcttgggctttcatgaatatctcttgtaattaat---aattaatcaatgaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52880936 |
attattcaatgggtatgggaaaattaccaggtgtacaggttactccattcttgggctttcatgaatatctcttgtaattaataataattaatcaatgaaa |
52881035 |
T |
|
| Q |
104 |
attaactttctttctttgtctcttcgtactctcatttcagataaatgcttcgtaatttttgcgagaaagaaggaaaataaaatgtttttaagtttaccat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52881036 |
attaactttctttctttgtctcttcgtactctcatttcagataaatgcttcgtaatttttgcgagaaagaaggaaaataaaatgtttttaagtttaccat |
52881135 |
T |
|
| Q |
204 |
tgtttctctcggag |
217 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52881136 |
tgtttctctcggag |
52881149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 936 times since January 2019
Visitors: 4362