View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690-Insertion-8 (Length: 175)
Name: NF0690-Insertion-8
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0690-Insertion-8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 174
Target Start/End: Original strand, 40985964 - 40986130
Alignment:
| Q |
8 |
atattgttccaattcactctgcaaattggagatgcttgcagatgagaaatgtaactcatcatgtccagacttaaggaatgaaagcagtttgatataatct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40985964 |
atattgttccaattcactctgcaaattggagatgcttgcagatgagaaatgtaactcatcatgtccagacttaaggaatgaaagcagtttgatataatct |
40986063 |
T |
 |
| Q |
108 |
cgatcttcctgaaaatccgtcagacaaaagtcattacaatgaaaaatatcaatattgagcacaagta |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40986064 |
cgatcttcctgaaaatccgtcagacaaaagtcattacaatgaaaaatatcaatattgagcacaagta |
40986130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University