View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690-Insertion-9 (Length: 146)
Name: NF0690-Insertion-9
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0690-Insertion-9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 146
Target Start/End: Original strand, 40957387 - 40957525
Alignment:
| Q |
8 |
tgaactaccttaaaagtcacccaaaagattatttgtgattagtgtaaaagatctttacactgttattgacaatgcatgctaatttcattannnnnnnacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40957387 |
tgaactaccttaaaagtcacccaaaagattatttgtgattagtgtaaaagatctttacactgttattgacaatgcatgctaatttcattatttttttacc |
40957486 |
T |
 |
| Q |
108 |
ttttagattagcatccctgttttgttttgttctgttctg |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40957487 |
ttttagattagcatccctgttttgttttgttctgttctg |
40957525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University