View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690_low_13 (Length: 315)
Name: NF0690_low_13
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0690_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 6102224 - 6102084
Alignment:
| Q |
93 |
ttggctccatttcttcatccaatataggtagaaggtgtcgccattccagcttaaagcgcggcaaaatgtgatacttcgtttattgtgccaattaaggact |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||| | |||||||||||||||||||||| |
|
|
| T |
6102224 |
ttggctccatttcttcatccaatataggtagaaggtgtcgccattccagcttaaagcgccgcaaa-tgcgatactccatttattgtgccaattaaggact |
6102126 |
T |
 |
| Q |
193 |
tcgcaacaatatggcatccacttcaactaatctacaagttgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6102125 |
tcgcaacaatatggcatccacttcaactaatccacaagttgt |
6102084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 93 - 151
Target Start/End: Complemental strand, 30453151 - 30453093
Alignment:
| Q |
93 |
ttggctccatttcttcatccaatataggtagaaggtgtcgccattccagcttaaagcgc |
151 |
Q |
| |
|
||||||| ||||| || |||||||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
30453151 |
ttggctcaatttcgtcgtccaatataggtagcaggtgtcgccattccggcttgaagcgc |
30453093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 93 - 149
Target Start/End: Complemental strand, 24734024 - 24733968
Alignment:
| Q |
93 |
ttggctccatttcttcatccaatataggtagaaggtgtcgccattccagcttaaagc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24734024 |
ttggctccatttcttcatccaatataggtagaaggtgtcgccattccggcttaaagc |
24733968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 93 - 151
Target Start/End: Complemental strand, 13886999 - 13886941
Alignment:
| Q |
93 |
ttggctccatttcttcatccaatataggtagaaggtgtcgccattccagcttaaagcgc |
151 |
Q |
| |
|
||||||| |||||||| || ||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
13886999 |
ttggctcaatttcttcgtctgatacaggtagaaggtgtcgccattccggcttgaagcgc |
13886941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University