View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690_low_14 (Length: 314)
Name: NF0690_low_14
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0690_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 93 - 274
Target Start/End: Original strand, 7549483 - 7549664
Alignment:
| Q |
93 |
taattgacttccaaagtagcaaagatagaatagaggaattaaaatggccttcagccagcgtgtgagaaagctctgcaaaaactgacaaagatgttttgaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7549483 |
taattgacttccaaagtagcaaagatagaatagaggaattaaaatggccttcagccagcgtgtgagaaagctctgcaaaaactgacaaagatgttttgaa |
7549582 |
T |
|
| Q |
193 |
atcaaattgaagcttcatcactctacttggaattaacattctatggcaggtaggtattaaagaaagaaagtatattgtattg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7549583 |
atcaaattgaagcttcatcactctacttggaattaacattctatggcaggtaggtattaaagaaagaaagtatattgtattg |
7549664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1164 times since January 2019
Visitors: 4407