View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690_low_16 (Length: 291)
Name: NF0690_low_16
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0690_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 52 - 237
Target Start/End: Complemental strand, 18477703 - 18477518
Alignment:
| Q |
52 |
caaaggcagcagttagctaattcattagaacccagcatctatccttgattaaaatatgtgtggcaatagagtaagtaatgtaacagagaaagcaaggaga |
151 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
18477703 |
caaaggcagtagttagctaattcattagaaaccagcatcaatccttgattaaaatatgtgtggcaatagagtaagtaatgaaacagggaaagcaaggaga |
18477604 |
T |
|
| Q |
152 |
atcacgtatctctaagaccaaccttccttcatataacaattgtaattaaagcagcaacatgtagctttatcttcatgactaacctt |
237 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18477603 |
atcatgtatctctaagaccaaccttccttcatataacaattgtaattaaagcagcaacatgtacctttatcttcatgactaacctt |
18477518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 220
Target Start/End: Original strand, 19061058 - 19061098
Alignment:
| Q |
180 |
tcatataacaattgtaattaaagcagcaacatgtagcttta |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
19061058 |
tcatataacaattgtaattaaagtagcaacatgtaccttta |
19061098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1293 times since January 2019
Visitors: 4413