View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0690_low_18 (Length: 275)

Name: NF0690_low_18
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0690_low_18
NF0690_low_18
[»] chr1 (2 HSPs)
chr1 (1-168)||(32183833-32184003)
chr1 (211-262)||(32184000-32184049)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 32183833 - 32184003
Alignment:
1 cttgataacaaagttcttgttctgctgcctattgctttggttgatgaactcaaccaagctatgcaatggttgaaccaagctagctagctaactatttatt 100  Q
    ||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||| ||    
32183833 cttgaaaacaaaggtcttgttctgctgcctattgctttggttgatgaactgaaccaggctatgcaatggttgaaccaagctagctagataactatttttt 32183932  T
101 tttac---tctccactatggttgatttatattttgtatgtttggattattaggtatgtgaaccaagctaac 168  Q
    ||| |   ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32183933 ttttcttttctgcattatggttgatttatattttgtatgtttggattattaggtatgtgaaccaagctaac 32184003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 262
Target Start/End: Original strand, 32184000 - 32184049
Alignment:
211 taactcttgaaaatctatggtgctcaaaggtggcgtgtgtgttactgtttct 262  Q
    ||||||||||||||||||||| |||| |||||  ||||||||||||||||||    
32184000 taactcttgaaaatctatggtactcagaggtg--gtgtgtgttactgtttct 32184049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University