View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690_low_18 (Length: 275)
Name: NF0690_low_18
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0690_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 32183833 - 32184003
Alignment:
| Q |
1 |
cttgataacaaagttcttgttctgctgcctattgctttggttgatgaactcaaccaagctatgcaatggttgaaccaagctagctagctaactatttatt |
100 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
32183833 |
cttgaaaacaaaggtcttgttctgctgcctattgctttggttgatgaactgaaccaggctatgcaatggttgaaccaagctagctagataactatttttt |
32183932 |
T |
|
| Q |
101 |
tttac---tctccactatggttgatttatattttgtatgtttggattattaggtatgtgaaccaagctaac |
168 |
Q |
| |
|
||| | ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183933 |
ttttcttttctgcattatggttgatttatattttgtatgtttggattattaggtatgtgaaccaagctaac |
32184003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 262
Target Start/End: Original strand, 32184000 - 32184049
Alignment:
| Q |
211 |
taactcttgaaaatctatggtgctcaaaggtggcgtgtgtgttactgtttct |
262 |
Q |
| |
|
||||||||||||||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
32184000 |
taactcttgaaaatctatggtactcagaggtg--gtgtgtgttactgtttct |
32184049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1648 times since January 2019
Visitors: 4426