View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690_low_19 (Length: 272)
Name: NF0690_low_19
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0690_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 35 - 232
Target Start/End: Original strand, 7128360 - 7128557
Alignment:
Q |
35 |
atgacataaattaaatgttatcacatgcgtcagtgtcgtgtcggtattaaacattgatgcaagtgggacacgacacacattcgatcaattttcagtgcta |
134 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
7128360 |
atgacataaattaaatgttatcacatgcgtcagtgtcgtgtcggtattaaacaatgatgcaagtgggacacgacacacattcgatcaattatcagtgcta |
7128459 |
T |
 |
Q |
135 |
caatggctatgattttctgtttgatatgaattatattctctctaaatttgtaaagtttacataaggattgacttcctgttttcttgatgttgtacttg |
232 |
Q |
|
|
||| |||||||||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7128460 |
caaaggctatgattttctgtttgatatgcattatattctctctaattttttaaagtttacataaggattgacttcctgttttcttgatgttgtacttg |
7128557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University