View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0690_low_26 (Length: 220)

Name: NF0690_low_26
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0690_low_26
NF0690_low_26
[»] chr4 (1 HSPs)
chr4 (166-220)||(43544099-43544153)


Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 166 - 220
Target Start/End: Original strand, 43544099 - 43544153
Alignment:
166 gcggcggtggttttggccctagattcggcaacggtcacgcaagtgatagaaagta 220  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
43544099 gcggtggtggttttggccctagattcggcaacggtcacgcaagtgatagaaagta 43544153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University