View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690_low_26 (Length: 220)
Name: NF0690_low_26
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0690_low_26 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 166 - 220
Target Start/End: Original strand, 43544099 - 43544153
Alignment:
Q |
166 |
gcggcggtggttttggccctagattcggcaacggtcacgcaagtgatagaaagta |
220 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43544099 |
gcggtggtggttttggccctagattcggcaacggtcacgcaagtgatagaaagta |
43544153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University