View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0690_low_3 (Length: 647)
Name: NF0690_low_3
Description: NF0690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0690_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 7e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 7e-57
Query Start/End: Original strand, 352 - 537
Target Start/End: Original strand, 43102884 - 43103061
Alignment:
| Q |
352 |
agtgaaccgattgcaagttcaagttctcctaggtagccaaggaacatcatggacaccatggaacgagaataaaaaataagagctgttatgggcctatggc |
451 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
43102884 |
agtgaaccggctgcaagttcaagttctcctaggtagcctaaaaacatcatggacaccatggaacgagaatagaaaataagagctgttatg--------gc |
43102975 |
T |
 |
| Q |
452 |
tattgggaaaacaaggatcattagggatttcatttcttccatgatggttgaaaaggaacatgtatttggtttcgtgtggtcactta |
537 |
Q |
| |
|
|||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
43102976 |
tattggaaaagcaagcatcattagggatttcatttcttccatgatggttgaaaaggaacatgtatttggtttggtgtagtcactta |
43103061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 212 - 324
Target Start/End: Original strand, 43102705 - 43102819
Alignment:
| Q |
212 |
taagccacatgaagtgaatgggaatggaacatagctataagaagaggatgcaacgttgaagggttaatgat-ggagtttaggac-gtttgctccgaaggc |
309 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||| ||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
43102705 |
taagccacatgaaggaaatgggaatggaacatagtaataggaagaggatgcaacgttgaagtgttaaggataggagtttaggacggtttgctccgaaggc |
43102804 |
T |
 |
| Q |
310 |
ttgtgaacagagagg |
324 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43102805 |
ttgtgaacagagagg |
43102819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 41 - 157
Target Start/End: Original strand, 46635060 - 46635176
Alignment:
| Q |
41 |
caatttgaactaacccatgacttaacagttagagagctttgtgggtaatgataattgcatcccaactacaaaccttgattccccaaattagttttttcct |
140 |
Q |
| |
|
||||||| || |||||||| |||| |||| ||| || ||||||||| |||||||||||| | ||| | |||||||| | |||||||||||||||| || |
|
|
| T |
46635060 |
caatttgcacaaacccatggcttagcagtaagaaagttttgtgggtgatgataattgcaactcaattgcaaaccttaaatccccaaattagttttcccca |
46635159 |
T |
 |
| Q |
141 |
atttttaatttgaaatt |
157 |
Q |
| |
|
||||| ||||| ||||| |
|
|
| T |
46635160 |
attttaaatttaaaatt |
46635176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University