View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0692-Insertion-11 (Length: 139)
Name: NF0692-Insertion-11
Description: NF0692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0692-Insertion-11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 47282831 - 47282722
Alignment:
| Q |
8 |
tgatatttcttagaactgaacttccattaatatttgggtgtgcataaaaaatggacaccaagttaattttgagggaagtttccatcttatgtgtagtcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47282831 |
tgatatttcttagaactgaacttccaaatatatttgggtgtgcataaaaaatggacac-aagttaattttgagggaagtttccatcttatgtgtagtcat |
47282733 |
T |
|
| Q |
108 |
catataggtag |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
47282732 |
catataggtag |
47282722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1201 times since January 2019
Visitors: 4365