View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0692-Insertion-12 (Length: 66)
Name: NF0692-Insertion-12
Description: NF0692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0692-Insertion-12 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 9 - 66
Target Start/End: Original strand, 52372075 - 52372132
Alignment:
Q |
9 |
gttgttcctcttttaaataatgtcaactcaattgaataagtattcgataggagtggca |
66 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
52372075 |
gttgttcctcttttaaatcatgtcaactcaattgaataagtattcgatagcagtggca |
52372132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University