View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0692-Insertion-4 (Length: 377)
Name: NF0692-Insertion-4
Description: NF0692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0692-Insertion-4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 165 - 352
Target Start/End: Original strand, 13851028 - 13851211
Alignment:
| Q |
165 |
tattttttattacaaaaaagtcctacaatggtgaaccctaatagagaagagaaataacttagagatatataaaattgttaacaaatcttattatggttga |
264 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13851028 |
tattttttattacaaaaaaatcctacaatggtgaaccctaatagacaagagaaataacttagagatatataaaattgttaacaaatcttattatggttga |
13851127 |
T |
|
| Q |
265 |
ttaattagtgagtttcgcacaagaatagctacaattgtattgcctaaacgtgaatatgaatgaatgattgagaagattgggtgaaccg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13851128 |
ttaattagtgagtttcgcacaagaatagctacaattgtattgcctaaaagtgaat----atgaatgattgagaagattgggtgaaccg |
13851211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 161
Target Start/End: Original strand, 13850885 - 13851003
Alignment:
| Q |
48 |
caaaaaatattctgggtaagaatcaaatagtaaaatgaagaagnnnnnnnnngtgtcttcaat---ctatgtaattgcaatcattg---atatgatgggt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||| || |
|
|
| T |
13850885 |
caaaaaatattctgggtaagaatcaaatagtaaaatgaagaag-aaaaaaaagtgtcttcaatctactatgtaattgcaatcattgataatatgatgagt |
13850983 |
T |
|
| Q |
142 |
tggagtacatcttttactct |
161 |
Q |
| |
|
| | |||||||||||||||| |
|
|
| T |
13850984 |
tcgggtacatcttttactct |
13851003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 53
Target Start/End: Original strand, 13850471 - 13850519
Alignment:
| Q |
5 |
acatgcatatcttcatgtaataattcaatgtaagaaattgttacaaaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13850471 |
acatgcatatcttcatgtaataattcaatgtaagaaattgttataaaaa |
13850519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 877 times since January 2019
Visitors: 4356