View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0692-Insertion-6 (Length: 271)
Name: NF0692-Insertion-6
Description: NF0692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0692-Insertion-6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 216
Target Start/End: Original strand, 13134266 - 13134469
Alignment:
Q |
13 |
aaaggtatatatgatgatgatggagagcccagatctttccccacctcaaatagacacatctcgaccgtccctcggtttcccactaggtactggtctcctc |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
13134266 |
aaaggtatatatgatgatgatggagagcccagatctttccccacctcaaatagacacatctcgaccgtccctcggtttcccactaggtactgctctcctc |
13134365 |
T |
 |
Q |
113 |
ttggtcatcatcttcagcttaagtggtatcttctcatgttggtaccactgggaaaagtttcgttcacttcatcaatctctctctcatcttgaggctgcac |
212 |
Q |
|
|
||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13134366 |
ttgctcatcatcttcagcttaagtggtatcttctcatgttgctaccactgggaaaagtttcgttcacttcatcaatctctctctcatcttgaggctgcac |
13134465 |
T |
 |
Q |
213 |
aagc |
216 |
Q |
|
|
|||| |
|
|
T |
13134466 |
aagc |
13134469 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 96 - 216
Target Start/End: Complemental strand, 30237300 - 30237180
Alignment:
Q |
96 |
taggtactggtctcctcttggtcatcatcttcagcttaagtggtatcttctcatgttggtaccactgggaaaagtttcgttcacttcatcaatctctctc |
195 |
Q |
|
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
30237300 |
taggtactgctctcctcttgctcatcatcttcagcttaagtggtatcttctcatgttgctaccactgggaaaagtttctttcacttcatcaatctctctc |
30237201 |
T |
 |
Q |
196 |
tcatcttgaggctgcacaagc |
216 |
Q |
|
|
|||||||||| || ||||||| |
|
|
T |
30237200 |
tcatcttgagtctccacaagc |
30237180 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 30237337 - 30237302
Alignment:
Q |
26 |
atgatgatggagagcccagatctttccccacctcaa |
61 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
30237337 |
atgatgatggagagcccagatctttccccacctcaa |
30237302 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University