View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0692_high_7 (Length: 250)
Name: NF0692_high_7
Description: NF0692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0692_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 88 - 222
Target Start/End: Original strand, 43355552 - 43355693
Alignment:
Q |
88 |
gagcaagaattttcttatattattcaactatcaattttgttcctnnnnnnnnnctatcaatttttgttat-------attgtattttaacaagtctttct |
180 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
43355552 |
gagcaagaattttcttatattattcaactatcaattttgttcctaaaaataaactatcaatttttgttatttattatattgtattttaacaagtctttct |
43355651 |
T |
 |
Q |
181 |
tgatggtcacccactcaccaggccccgggatcagtagaaagt |
222 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43355652 |
cgatggtcacccactcaccaggccccgggatcagtagaaagt |
43355693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 43355459 - 43355505
Alignment:
Q |
1 |
catgtaatagtaagtttctctcattaagaaaaggtaatagtgaatta |
47 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
43355459 |
catgtaatagtaagtttctctcgttaagaaaaggtaatagtgaatta |
43355505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 137 times since January 2019
Visitors: 4370