View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0692_low_13 (Length: 224)

Name: NF0692_low_13
Description: NF0692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0692_low_13
NF0692_low_13
[»] chr4 (1 HSPs)
chr4 (170-224)||(43544099-43544153)


Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 170 - 224
Target Start/End: Original strand, 43544099 - 43544153
Alignment:
170 gcggcggtggttttggccctagattcggcaacggtcacgcaagtgatagaaagta 224  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
43544099 gcggtggtggttttggccctagattcggcaacggtcacgcaagtgatagaaagta 43544153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University