View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0692_low_15 (Length: 217)

Name: NF0692_low_15
Description: NF0692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0692_low_15
NF0692_low_15
[»] chr7 (1 HSPs)
chr7 (1-140)||(18352819-18352958)


Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 18352819 - 18352958
Alignment:
1 tgtgaaggatcctaattatggtggttagaaagaactaagaacattttgttcatactattttggaaaataaaccttttgtatatttgtgcatgtgtaatct 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18352819 tgtgaaggatcctaattatggtggttagaaagaactatgaacattttgttcatactattttggaaaataaaccttttgtatatttgtgcatgtgtaatct 18352918  T
101 tacgagtaatgccagctgataacactcattttagtataat 140  Q
    ||||||||||||||| | || |||||||||||| ||||||    
18352919 tacgagtaatgccagttaatgacactcattttaatataat 18352958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University