View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_high_10 (Length: 314)
Name: NF0693_high_10
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0693_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 4 - 307
Target Start/End: Complemental strand, 26846698 - 26846395
Alignment:
Q |
4 |
gaacaagaagaagaagcacggatcttttcgcctgtgagaagaaacctgctggtttgcgtggtaagtttgttgatttcatggataggaatgtcacattccc |
103 |
Q |
|
|
||||||||||||||||||| ||||||| |||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26846698 |
gaacaagaagaagaagcaccgatctttacgcctgtgagaagaaacctgttgtgttgcttggtaagtttgttgatttcatggataggaatgtcacattccc |
26846599 |
T |
 |
Q |
104 |
tgcatagtagggctttgtcttctttgcaaaatagatatgcacgcctctcctgcaataaaaatgttatttcctatattgctcggtcttttattttaaacat |
203 |
Q |
|
|
|||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
26846598 |
tgcaaagtattgctctgtcttctttgcaaaatagatatgcacgcctctcctgcaataaaaatgttatttcctatattgctcagtcttttattttaaacat |
26846499 |
T |
 |
Q |
204 |
taaacaaatatgaccatatttttggatcatataggctatgatcttcatcctattgtattgataaacaagttttaaatcgtgcgcgtgtgatattgatatt |
303 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
26846498 |
taaacaaatatgaccatatttttggatcatataagctatgatcttcatcctattttattgataaacaagttttaaatcgtgctcgtgtgatattgatatt |
26846399 |
T |
 |
Q |
304 |
gttg |
307 |
Q |
|
|
|||| |
|
|
T |
26846398 |
gttg |
26846395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 80 - 164
Target Start/End: Complemental strand, 54881202 - 54881118
Alignment:
Q |
80 |
catggataggaatgtcacattccctgcatagtagggctttgtcttctttgcaaaatagatatgcacgcctctcctgcaataaaaa |
164 |
Q |
|
|
||||||| |||| ||||||||| |||||||| | ||| | ||||||| ||||||||||||| |||||||||||||||| ||||| |
|
|
T |
54881202 |
catggattggaaggtcacattctctgcatagaatcgctctatcttcttggcaaaatagatatccacgcctctcctgcaacaaaaa |
54881118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1502 times since January 2019
Visitors: 4421