View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_high_20 (Length: 228)
Name: NF0693_high_20
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0693_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 29947329 - 29947531
Alignment:
| Q |
1 |
ttgatgttgaatttgaattatgaatgatattgaggaagagaagaaagtacctgagcaggagaagagttttgcatgaggtgaagaaggtttgatgttgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29947329 |
ttgatgttgaatttgaattatgaatgatattgaggaagagaagaaagtacctgagcaggagaagagtgttgcatgaggtgaagaaggtttgatgttgatt |
29947428 |
T |
 |
| Q |
101 |
gcactgtctgtgagatttgctcggcgactactgccttcgctgaattgtcgccgccggtagctgcgttttgcgtcgacataggtcgccacaacggccttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29947429 |
gcactgtctgtgagatttgctcggcgactactgccttcgctgaattgtcgccgccggtagctgcgttttgcgtcgacataggtcgccacagcggccttcg |
29947528 |
T |
 |
| Q |
201 |
tct |
203 |
Q |
| |
|
||| |
|
|
| T |
29947529 |
tct |
29947531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University