View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_11 (Length: 371)
Name: NF0693_low_11
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0693_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 30 - 359
Target Start/End: Complemental strand, 3158023 - 3157693
Alignment:
Q |
30 |
tccgggtggtgtctttattcttgctctattatgttgatatttctactttctgtgatggctcgtgggttcaaattatattcaccaagataaattcaaacat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3158023 |
tccgggtggtgtctttattcttgctctattatgttgatatttctactttctgtgatggctcgtgggttcaaattatattcaccaagataaattcaaacat |
3157924 |
T |
 |
Q |
130 |
ctctttaatacattatttattgatttatgttcatttattggccagtaatattacttgaattttgaaaataaaataaag-aattatatttgtataaaattt |
228 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
3157923 |
ctctttaatatattatttattgatttatgttcatttattggccagtaatattacttgaattttgaaaataaaataaagaaattatatttgtataaaattt |
3157824 |
T |
 |
Q |
229 |
ttggacaattttatctcttatatacggattgtgtttttatttcatctcttcnnnnnnnnncctctcaattttaccaacattgtctttattaaatgaaaat |
328 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
3157823 |
ttggacaattttatctcttatacacggattgtgtttttatttcatctcttctttttttttcctctcaattttacctacattgtctttattaaaagaaaat |
3157724 |
T |
 |
Q |
329 |
tatattaatgtcatttcatagttatcatatt |
359 |
Q |
|
|
|||||||||| |||||||||||||||||||| |
|
|
T |
3157723 |
tatattaatgccatttcatagttatcatatt |
3157693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1508 times since January 2019
Visitors: 4421