View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0693_low_13 (Length: 362)

Name: NF0693_low_13
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0693_low_13
NF0693_low_13
[»] chr8 (1 HSPs)
chr8 (93-346)||(1016895-1017148)


Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 93 - 346
Target Start/End: Original strand, 1016895 - 1017148
Alignment:
93 ctttcatgacacatcagctccggcagccctggcaccgatttcacggagtccaagttttcggagcattttctttggggagaattgggcggagctgccgctg 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1016895 ctttcatgacacatcagctccggcagccctggcaccgatttcacggagtccaagttttcggagcattttctttggggagaattgggcggagctgccgctg 1016994  T
193 aaggaggatgataccgaagacatggtcatctatggagctttgcgcgaagctgctgccaccacgggctggttcccggctagtaacaaagtggtgaacaatg 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
1016995 aaggaggatgataccgaagacatggtcatctatggagctttgcgcgaagctgctgccaccacgggctggttcccgcctagtaacaaagtggtgaacaatg 1017094  T
293 ttgatatggcggtgaaaatagaagatcaaggtcaaagcagtggaacttcattgg 346  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1017095 ttgatatggcggtgaaaatagaagatcaaggtcaaagcagtggaacttcattgg 1017148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University