View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_13 (Length: 362)
Name: NF0693_low_13
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0693_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 93 - 346
Target Start/End: Original strand, 1016895 - 1017148
Alignment:
| Q |
93 |
ctttcatgacacatcagctccggcagccctggcaccgatttcacggagtccaagttttcggagcattttctttggggagaattgggcggagctgccgctg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1016895 |
ctttcatgacacatcagctccggcagccctggcaccgatttcacggagtccaagttttcggagcattttctttggggagaattgggcggagctgccgctg |
1016994 |
T |
|
| Q |
193 |
aaggaggatgataccgaagacatggtcatctatggagctttgcgcgaagctgctgccaccacgggctggttcccggctagtaacaaagtggtgaacaatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1016995 |
aaggaggatgataccgaagacatggtcatctatggagctttgcgcgaagctgctgccaccacgggctggttcccgcctagtaacaaagtggtgaacaatg |
1017094 |
T |
|
| Q |
293 |
ttgatatggcggtgaaaatagaagatcaaggtcaaagcagtggaacttcattgg |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1017095 |
ttgatatggcggtgaaaatagaagatcaaggtcaaagcagtggaacttcattgg |
1017148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1540 times since January 2019
Visitors: 4422