View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_14 (Length: 359)
Name: NF0693_low_14
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0693_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 256
Target Start/End: Original strand, 26839963 - 26840189
Alignment:
| Q |
30 |
aaatgcataattaatgtaagaaatggaaagaacgtacttcttgttgttgtggaaatgatgatgaagaatgtggattaggaaaagaagagagagtattagt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26839963 |
aaatgcataattaatgtaagaaatggaaagaacgtacttgttgttgttgtggaaatgatgatgaagaatgtggattaggaaaagaagagagagtattagt |
26840062 |
T |
 |
| Q |
130 |
ggaagcagagatagagaaggggttcattattctcatccttcgtgcaggaaggatagttggttcggtggcgggagagaggtctctacttacccttgcgtat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26840063 |
ggaagcagagatagagaaggggttcattattctcatccttcgtgcaggaaggatagttggttcggtggcgggagagaggtctctactgacccttgcgtat |
26840162 |
T |
 |
| Q |
230 |
ccgaatcccaaccatacaataaaactc |
256 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
26840163 |
ccgaatcccaaccatacaataaaactc |
26840189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 292 - 346
Target Start/End: Original strand, 26840734 - 26840788
Alignment:
| Q |
292 |
cacacgcccacaaaaaacaactaactacgacgtcgacaataggataaccacacct |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
26840734 |
cacacgcccacaaaaaacaactaactacgacgttgacaataggacaaccacacct |
26840788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University