View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_19 (Length: 329)
Name: NF0693_low_19
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0693_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 42551129 - 42550829
Alignment:
Q |
1 |
accaccgttggattccaacacaagaagagcaacggtacttcactccctcgacgacgcgtaagggctctccagagagcttctgaagcagtaataactgcca |
100 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42551129 |
accaccgttggattccaacacaagaagaacaacggtacttcactccctcgtcgacgcgtaagggctctccagagagcttctgaagcagtaataactgcca |
42551030 |
T |
 |
Q |
101 |
taaagtcattgtcctcacaaaagagtgctaaaacaaagaaagcttccactggtgttctttctaggagcttctcaaggaagctgttaagtcggagattctg |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42551029 |
taaagtcattgtcctcacaaaagagtgctaaaacaaagaaaacttccactggtgttctttctaggagcttctcaaggaagctgttaagtcggagattctg |
42550930 |
T |
 |
Q |
201 |
gagaaaagcagtgaaggaagagggaagtgaaggtgtattgaggtgtaagagatctttccgggaactacttatgcaggaacgagattataaaccaacgtcg |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42550929 |
gagaaaagcagtgaaggaagagggaagtgaaggtgtattgaggtgtaagagatctttccgggaactacttatgcaggaacgagattataaaccaacgtcg |
42550830 |
T |
 |
Q |
301 |
t |
301 |
Q |
|
|
| |
|
|
T |
42550829 |
t |
42550829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University