View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_24 (Length: 298)
Name: NF0693_low_24
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0693_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 130 - 269
Target Start/End: Original strand, 41668085 - 41668224
Alignment:
| Q |
130 |
cgaaattatttgattccaggatcacagnnnnnnncattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668085 |
cgaaattatttgattccaggatcacagaaaaaaacattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatg |
41668184 |
T |
|
| Q |
230 |
agtagtaaccttcaacccaaatcttgcccaacattgtgcc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668185 |
agtagtaaccttcaacccaaatcttgcccaacattgtgcc |
41668224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 28 - 109
Target Start/End: Complemental strand, 4804340 - 4804259
Alignment:
| Q |
28 |
atataccgcatttggtcacaattctccacaatattaaggatcaaaacatgacaaaaacttcattgtgattgctattaaaacg |
109 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
4804340 |
atataccgcatttggtcacgattctccacaatattaacgatcaaaacgtgacaaaaacttcatcgtgattgctattaaaacg |
4804259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 33 - 89
Target Start/End: Complemental strand, 4805478 - 4805422
Alignment:
| Q |
33 |
ccgcatttggtcacaattctccacaatattaaggatcaaaacatgacaaaaacttca |
89 |
Q |
| |
|
||||||||| ||||| |||||||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
4805478 |
ccgcatttgatcacagttctccacaatagtaaggatcaaaatgtgaccaaaacttca |
4805422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 408 times since January 2019
Visitors: 4381