View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_29 (Length: 260)
Name: NF0693_low_29
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0693_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 31 - 252
Target Start/End: Original strand, 43522912 - 43523133
Alignment:
| Q |
31 |
ttctaagtctctgtcatcatctcatgcatggtggtgcattaccggtcattaccatagacataactccacgcatgtatgagtgtgggttttcttttgtttt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43522912 |
ttctaagtctctgtcatcatctcatgcatggtggtgcattaccggtcattaccatagacataactccacgcatgtatgagtgtgggttttcttttgtttt |
43523011 |
T |
|
| Q |
131 |
agtctcatctactcatgacacgtgttgtttgatgatttagtacatgctgactcgatcggtttcatatgcttatgtctcagaacacacctcacattgtcac |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43523012 |
agtctcatctactcatgacacgtgttgtttgatgatttagtacatgctgactcgatcggtttcatatgcttatgtctcagaacacacctcacattgtcac |
43523111 |
T |
|
| Q |
231 |
atgcttgcttcctatattattc |
252 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43523112 |
atgcttgcttcctatattattc |
43523133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1017 times since January 2019
Visitors: 4400