View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0693_low_30 (Length: 259)

Name: NF0693_low_30
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0693_low_30
NF0693_low_30
[»] chr2 (1 HSPs)
chr2 (30-255)||(32904479-32904704)


Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 30 - 255
Target Start/End: Original strand, 32904479 - 32904704
Alignment:
30 gttggccccctccctattgtgtcctattgtctaaagattgcaacagttacattattgtaagtgtagtgatgcagatgatgccatccaatagcatgaaaat 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
32904479 gttggccccctccctattgtgtcctattgtctaaagattgcaacagttacattattgtaagtgtagtgatgcagatgatgccatccaacagcatgaaaat 32904578  T
130 ggaaagttggataaaaagacactttgaaaaattggtgcttggcattggtatggctaaacgatattcaatgatgataacattgatgtctctaattgagaga 229  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
32904579 ggaaagttggataaaaaaacactttgaaaaattggtgcttggcattggtatggctaaacgatattcaatgatgataacattgatgtctctaattgagcga 32904678  T
230 ttgttagtgataatcacatagtaaaa 255  Q
    ||||||||||||||||||||||||||    
32904679 ttgttagtgataatcacatagtaaaa 32904704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1828 times since January 2019
Visitors: 4432