View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_30 (Length: 259)
Name: NF0693_low_30
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0693_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 30 - 255
Target Start/End: Original strand, 32904479 - 32904704
Alignment:
Q |
30 |
gttggccccctccctattgtgtcctattgtctaaagattgcaacagttacattattgtaagtgtagtgatgcagatgatgccatccaatagcatgaaaat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
32904479 |
gttggccccctccctattgtgtcctattgtctaaagattgcaacagttacattattgtaagtgtagtgatgcagatgatgccatccaacagcatgaaaat |
32904578 |
T |
 |
Q |
130 |
ggaaagttggataaaaagacactttgaaaaattggtgcttggcattggtatggctaaacgatattcaatgatgataacattgatgtctctaattgagaga |
229 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
32904579 |
ggaaagttggataaaaaaacactttgaaaaattggtgcttggcattggtatggctaaacgatattcaatgatgataacattgatgtctctaattgagcga |
32904678 |
T |
 |
Q |
230 |
ttgttagtgataatcacatagtaaaa |
255 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
32904679 |
ttgttagtgataatcacatagtaaaa |
32904704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University