View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0693_low_35 (Length: 245)

Name: NF0693_low_35
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0693_low_35
NF0693_low_35
[»] chr4 (1 HSPs)
chr4 (1-148)||(327840-327986)


Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 327986 - 327840
Alignment:
1 aatagttaattacacaattaatcatcagacattgatgaaagnnnnnnnnntactaacaataatttctttaaaaaataaattctaaattgtggtattctaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||| ||||||||||||||||||||||||    
327986 aatagttaattacacaattaatcatcagacattgatgaaagaaaaaaaaatactaacaataatttctttaaaaaa-aaattctaaattgtggtattctaa 327888  T
101 ccgcaattgtgaccgcgatataaaagttttagagattcgtacaacttc 148  Q
    ||||||||||||| || |||||||||||||||||||||||||||||||    
327887 ccgcaattgtgacagcaatataaaagttttagagattcgtacaacttc 327840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1854 times since January 2019
Visitors: 4432