View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_37 (Length: 233)
Name: NF0693_low_37
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0693_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 8683475 - 8683628
Alignment:
| Q |
1 |
tctacatgtttgtttgaatttcctagaggtttactatgacaatgagagggattcaaggtgctttgatcataagttcaagtttccaaatggctattggann |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683475 |
tctacatgtttgtttgaatttcctagaggtttactatgacaatgagagggattcaaggtgctttgatcataagttcaagtttccaaatggctattggatt |
8683574 |
T |
|
| Q |
101 |
nnnnnnnnnnnggagaaatgctgtcaggttagtatctgtaacgtcctttgtttc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
8683575 |
ttttggtttttggagaaatgctgtcaggttagtatctgtaacttcttttgtttc |
8683628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 400 times since January 2019
Visitors: 4381