View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_43 (Length: 203)
Name: NF0693_low_43
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0693_low_43 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 126 - 203
Target Start/End: Original strand, 38907482 - 38907559
Alignment:
Q |
126 |
attatactgaagatgcaggcccctcaacctcattcggaatatcgtccgcgaaagagaacgttgacaatatggatttat |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
T |
38907482 |
attatactgaagatgcaggcccctcaacctcattcggaagatcttccgcgaaagagaacgttgacaatatggatttat |
38907559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1745 times since January 2019
Visitors: 4429