View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0693_low_6 (Length: 458)
Name: NF0693_low_6
Description: NF0693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0693_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 98 - 448
Target Start/End: Complemental strand, 38039898 - 38039548
Alignment:
| Q |
98 |
gatgaggttagcgttgaagaaacccagcaaagttgctttttgaagcaaaaccattaataaagagaatataagattgctttagattaacatggggtactaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039898 |
gatgaggttagcgttgaagaaacccagcaaagttgctttttgaagcaaagccattaataaagagaatataagattgctttagattaacatggggtactaa |
38039799 |
T |
 |
| Q |
198 |
acatcgtcctgctttattctttttcccttgcttctttgaaatcctcatcatgtgtcttggtggtgatgttagattctcttcacacaattcaggttcttca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039798 |
acatcgtcctgctttattctttttcccttgcttctttgaaatcctcatcatgtgtcttggtggtgatgttagattctcttcacacaattcaggttcttca |
38039699 |
T |
 |
| Q |
298 |
atgatagtagaaagcttagaccttagaatttcctccatgtccttcctagactcatttctcctgctagtgcaaggcactgaccttaatattttcctgcatg |
397 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38039698 |
atgatagtagaaagcttagcccttagaatttcctccatgtccttcctagactcatttctcctgctcgtgcaaggcactgaccttaatattttcctgcatg |
38039599 |
T |
 |
| Q |
398 |
ccctcctcatttcttttgcttctgatttcaatctttacatttgcacctatg |
448 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039598 |
ccctcctcatttcttttgcttctgatttcaatctttacatttgcacctatg |
38039548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University