View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0694_high_3 (Length: 293)
Name: NF0694_high_3
Description: NF0694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0694_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 25 - 264
Target Start/End: Complemental strand, 52583398 - 52583159
Alignment:
| Q |
25 |
catcaaatggaagaagtagtatcatcttttgaaatgatagcaggtttgggagctgcaaagtgttacactgctctggcacttcaagcaatgtctaggcatt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583398 |
catcaaatggaagaagtagtatcatcttttgaaatgatagcaggtttgggagctgcaaagtgttacactgctctggcacttcaagcaatgtctaggcatt |
52583299 |
T |
 |
| Q |
125 |
tttgtagcttaagagatgccataatgtcccaaataaatgctgagaaaagaaaactgtttcaggatgtacctaaaattaatagtggattgtctcaactgag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583298 |
tttgtagcttaagagatgccataatgtcccaaataaatgctgagaaaagaaaactgtttcaggatgtacctaaaattaatagtggattgtctcaactgag |
52583199 |
T |
 |
| Q |
225 |
cttatttgagagagataataatagacagactagaatgtct |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583198 |
cttatttgagagagataataatagacagactagaatgtct |
52583159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University