View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0694_low_3 (Length: 361)
Name: NF0694_low_3
Description: NF0694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0694_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 30 - 353
Target Start/End: Complemental strand, 43014360 - 43014045
Alignment:
| Q |
30 |
acctaaatgagaaaagggattataaacaccattaaattatgtcatcatagttttaaaggtttgcagtgtaaccgcgaccgcgattactatacgtaccggc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43014360 |
acctaaatgagaaaagggattataaacaccattaaattatgtcaccatagttttaaaggttc--------accgcgaccgcgattactatacgtaccggc |
43014269 |
T |
 |
| Q |
130 |
ttgccttgatcaaatttgtgtccacagcgagggcagtgtttggatccacacaactggtgctcttccagcttagaatctatgagattagagctactaacgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43014268 |
ttgccttgatcaaatttgtgtccacagcgagggcagtgtttggatccacacaactggtgctcttccagcttagaatctatgagattagagctactaacgt |
43014169 |
T |
 |
| Q |
230 |
tgctcatcttattattcatcatcttttttgatgaaactttattaatataatactaagaaggtctttgtgttgaattggaattcttttactatgaaatagt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43014168 |
tgctcatcttattattcatcatcttttttgatgaaactttattaatataatactaagaaggtctttgtgttgaattggaattcttttactatgaaatagt |
43014069 |
T |
 |
| Q |
330 |
tctccaacacctcttagaataatc |
353 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
43014068 |
tctccaacacctcttagcataatc |
43014045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University