View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0695_low_14 (Length: 258)
Name: NF0695_low_14
Description: NF0695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0695_low_14 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 30 - 258
Target Start/End: Original strand, 3844740 - 3844968
Alignment:
Q |
30 |
taattctttgtgatcgatgaaaatgagataatggcattaattttgcattccaacaacgtatctttcatggtcagttttgccaataagaatggacaatgat |
129 |
Q |
|
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
3844740 |
taatcctttgtgatcgatgaaaacgagataatggcattaattttgcattccaacaacgtatctttcatggtcagttttgccaataagaatggacaacgat |
3844839 |
T |
 |
Q |
130 |
atttattcgccaaccagattacagtgacaccaggttttgtattttctcttgaaatgggatttgatttctgacagacaaaaacaaaatctcccttgtggtt |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
3844840 |
atttattcgccaaccagattacagtgacaccaggttttgtattttctattgaaatgggatttgatttctgacagacaaaaacaaaatctccgttgtggtt |
3844939 |
T |
 |
Q |
230 |
ccacatacacagggatattgatgctgctt |
258 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
3844940 |
ccacatacacagggatattgatgctgctt |
3844968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 209 times since January 2019
Visitors: 4374